
  • Family IS1595
  • Group IS1595
MGE type ISRelated element(s) :
Isoform Synonym(s)
Accession numberTranspositionOriginHost
CP015139 ND Escherichia coli
Escherichia coli Ecol_732 pEC732_IMP14
DNA section
IS Length : 1018 bp


IR Length : 20/24

IRL : cctgattaccaccatgcttcagcccctcaggactatacttaaagtatcct

Insertion site

Left flankDirect repeatRight flankDR Length

DNA sequence

Protein section
ORF number : 1


LengthBeginEndStrandFusion ORF
945 bp314 aa691013+No
ORF function : Transposase
Chemistry : DDE

ORF sequence :



Blast result :
ISEc70 is 75% aa similar to ISPma1.
1] Thomas Jové (2016) Direct submission.
2] Stoesser,N., Sheppard,A., Peirano,G., Sebra,R., Lynch,T., Anson,L., Kasarskis,A., Motyl,M., Kazmierczak,K., Crook,D. and Pitout,J. (2016) Direct GenBank submission.