
  • Family IS21
  • Group
MGE type ISRelated element(s) :
Isoform Synonym(s)
Accession numberTranspositionOriginHost
LC075717 ND Pseudomonas aeruginosa
Pseudomonas aeruginosa NCGM 2991
DNA section
IS Length : 2520 bp


IR Length : 27

IRL : tgttgaatcacgagcaaaactgagccactgaagggtctccgtcacgtcca
IRR : tgttgaatcacgagcaaaactgagccaggcgtcacgtccaaaactgagcc

Insertion site

Left flankDirect repeatRight flankDR Length

DNA sequence

Protein section
ORF number : 2


LengthBeginEndStrandFusion ORF
1533 bp510 aa1171649+No
ORF function : Transposase
Chemistry : DDE

ORF sequence :



Blast result :
LengthBeginEndStrandFusion ORF
831 bp276 aa16392469+No
ORF function : Accessory Gene
AG : IS21 helper

ORF sequence :



Blast result :
ISPa65 is 99% (transposase) and 96% (IS21 helper) aa similar to ISAav1.
1] Thomas Jové (2016) Direct submission.
2] Tada,T. and Kirikae (2015) Direct GenBank submission.