
  • Family IS630
  • Group
MGE type ISRelated element(s) :
Isoform Synonym(s)
Accession numberTranspositionOriginHost
ND Acinetobacter lwoffii
Acinetobacter lwoffii
Acinetobacter lwoffii M2a
DNA section
IS Length : 1078 bp


IR Length : 24

IRL : agttgacaaaaataactaatgatgcgaaaaggtttttttagttaacagat
IRR : agtatccattaaaaagtaaacatgtattcttttccgaattggtttgatac

Insertion site

Left flankDirect repeatRight flankDR Length

DNA sequence

Protein section
ORF number : 3


LengthBeginEndStrandFusion ORF
456 bp151 aa59514+No
ORF function : Transposase
Description : First part of the transposase

ORF sequence :



Blast result :
LengthBeginEndStrandFusion ORF
582 bp193 aa4891070+No
ORF function : Transposase
Description : Second part of the transposase

ORF sequence :



Blast result :
LengthBeginEndStrandFusion ORF
1012 bp336 aa591070+Yes
ORF function : Transposase
Chemistry : DDE

ORF sequence :



Blast result :
ISAlw18 is 50% aa (transposase) similar to ISAcma15.
The third ORF is the putative ORFAB transposase reconstructed in silico by possible -1 frameshift.
One of the 5 ISAlw18 copies in strain M2a has a divergent IRR (agttgtcattaaaaagtaaacatg). Acinetobacter wuhouensis strain WCHAW010062 chromosome (CP033133.1) contains 27 intact and 1 interrupted copies of this variant.
1] Janos Kiss (2019) Direct submission.