
  • Family IS982
  • Group
MGE type ISRelated element(s) :
Isoform Synonym(s)
Accession numberTranspositionOriginHost
ND Acinetobacter lwoffii
Acinetobacter lwoffii
Acinetobacter lwoffii M2a
Acinetobacter sp. ACNIH1
DNA section
IS Length : 980 bp


IR Length : 13

IRL : acctgagttcgatataaaaaaagagtagaaaaaaagccctgtttttgtaa
IRR : acctgagttcgatgaaatccacttaaccttttagcatattttggaaagtt

Insertion site

Left flankDirect repeatRight flankDR Length

DNA sequence

Protein section
ORF number : 1


LengthBeginEndStrandFusion ORF
864 bp287 aa95958+No
ORF function : Transposase
Chemistry : DDE

ORF sequence :



Blast result :
ISAlw19 is 71% aa similar to ISVsa6.
Acinetobacter sp. ACNIH1 chromosome and its plasmid pACI-df08 contain 6 and 1 ISAlw19 copies, respectively, differing in 2-3 bp positions from ISAlw19 identified in A. lwoffii M2a.
1] Janos Kiss (2019) Direct submission.