ISPpu5

  • Family IS110
  • Group IS1111
MGE type ISRelated element(s) :
Isoform Synonym(s)
Accession numberTranspositionOriginHost
AJ233397 ND Pseudomonas putida
Pseudomonas putida P1
DNA section
IS Length : 1355 bp

Ends


IR Length : 13

IRL : ACCCCCGGCACCTTGTGAGGGCTACGCTTTCACAGGGTGTTTTATTTCGG
IRR : TCTATGGTCACCCCCGTTTTTGCAATACTGATTAGCGGGTGAAGTGGTTG

Insertion site


Left flankDirect repeatRight flankDR Length
CAAAACGCCGAGATTTATGG0

DNA sequence

ACCCCCGGCACCTTGTGAGGGCTACGCTTTCACAGGGTGTTTTATTTCGGAGACCTTAATCATGAGCGAGTTAGCATTAGTCGGTATCGATCTCGGCAAA
AATACATTCCACCTGCACGGTCAGGACAAGCCAGGGCGAGAGCTGTTCACAAGAAACTCTCTCGCCAGCAGATGATGAAGTTTTTTTGCAATCTCCCTGC
ATGCACCGTAGTTATGGAGGCTTGCGCTGGCTCGCATTTTGTGGCTAGAGAGCTGATGGCGATGGGGCATAAGGCCAAGCTGATTTCGCCGCAGTTCGTC
CGTCCATTTGTCAAAAGCAACAAGAACGACTTTGTAGATGCTGAGGCGATCTGCGAGGCTGCCGCACGTCCGACAATGCGTTTCGTCACACCCAAGACAG
AGGTTCAGCAACTGCTTTCAATGATGCATCGCATGCGGGAATCTCTGGTGCACGATCGCACTAAAGTGGTCAATCAGATGCATGGCTTTCTGCTTGAATT
CGGGATTAGCCTGCCGAAAGGCCAACAATGATGAAGCGTTTGGGGAGTATTCTGAGCGAGCATGAACTGCCGATTCGACTGACGGTGTTGCTACAGCGAT
TGCATAAGCACTTCAGTTATCTGGATGAGCAGATCAAGGAAATGGATAAAGAGCTTATCGGCCAACTTGCCGACGATGATCTTGGCAGTCGCTTGCTGAG
CATACCGTGTGTCGGCCCGATCACCGCCAGCCTGCTGGCTGCCGAAATGGGGGATGGCAAACAATACGGATGTAGCCGTGATTTCGCCGCGTCCGTAGGG
CTGGTGCCCCGGCAGCACAGCACGGGCGGCAAGGCGACTCTGCTGGGAATCAGCAAACGAGGCGATAAGAACCTCAGAAGATTGTTGGTGCAGTGCGCCA
GGGTTTACATGCTTAGGCTGAAATATCAGCACGGCGCTCTGGCCGATTGGGTGCGCTCAATGCTCTGTCGTCGCCACTCGAACGTCGTGGCCTGCGCTTT
GGCCAACAAGCTGGCACGAATCGCATGGGCGATAGCGGCTCACCATACGCAATTTGAAACCGGGCCAGAGGCTTTAGCTGCCTGAAGCTGATGTTGTGCT
GTGCTAAGAATCACCCACCTAGGTTTTGCGATGACTGAACAATCGATGACGTGAACGGCCCTCCGGCCTGGCGAAGAACCTGATCCATAAACCGGCTATA
TAAAGCCGCTGGGGTTTTTAGGATCGTCAGGCGCGACTCTCATCGTGGCGCGGGGCATGCCCCAGATAGACGCCGGATAGATTTAAGCAAGCCAACCACT
TCACCCGCTAATCAGTATTGCAAAAACGGGGGTGACCATAGA
Protein section
ORF number : 0

 

Comments
ISPpu5 is a relative of IS1328. Comparison of the inverted repeats shows that 6 bases of the left inverted repeat (and probably also the direct repeat and the actual target site) were replaced by the end of ISPpu4. ISPpu5 does not encode a functional transposase. The tnpA gene is interupted by several frameshifts.
The IRl end of ISPpu5 has been interrupted by insertion of ISPpu4, resulting in loss of the outer 6 bp of IRl. The length of this element has been therefore been predicted by analogy with other IS1111 family elements, assuming that 7 nt would separate IRl from the left-hand end of the complete element and that 4 nt separate IRr from the right-hand end.

The ISPpu5 transposase gene is interrupted by several frameshifts, suggesting that it does not encode a functional transposase protein.
References
1] van Beilen, J. B., Röthlisberger, M. and Witholt, B. Direct submission.
2] van Beilen,J.B., Panke,S., Lucchini,S., Franchini,A.G., Rothlisberger,M. and Witholt,B. (2001) Microbiology 147 (Pt 6), 1621-1630
3] Partridge and Hall (2003) J. Bacteriol. 185, 6371-6384