ISRhf1

  • Family IS3
  • Group IS3
MGE type ISRelated element(s) :
Isoform Synonym(s) IS-Rf
Accession numberTranspositionOriginHost
Y Rhodococcus fascians
Rhodococcus fascians DSM20131
Brevibacterium lactofermentum ATCC13869
Corynebacterium herculis DSM20301
DNA section
IS Length : 1300 bp

Ends


IR Length : 15/19

IRL : GGACCTGACCCCCATTTGGN
IRR : GGGCCGACCCCGATATGGN

Insertion site


Left flankDirect repeatRight flankDR Length
AACGATGTAACCTTTACTTACTC3

DNA sequence

-
Protein section
ORF number : 0

 

Comments
ISRhf1 was trapped into the sacB-based suicide vector (Jäger et al., 1995). Based on its IR sequences, ISRhf1 is certainly (closely) related to IS1206 from Corynebacterium glutamicum B115.
References
1] Jäger, W., Schäfer, A., Kalinowski, J., and Pühler, A. (1995) FEMS Microbiol. Lett. 126, 1-6.